bacterial strains Search Results


90
Addgene inc 270 gcaattgttgttgttaaattccgttttgcgacgatgc
270 Gcaattgttgttgttaaattccgttttgcgacgatgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/ppr0386004-147-55-71?v=Addgene+inc
Average 90 stars, based on 1 article reviews
270 gcaattgttgttgttaaattccgttttgcgacgatgc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc e coli c321 δa exp
E Coli C321 δa Exp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/us10563230-100-10-16?v=Addgene+inc
Average 93 stars, based on 1 article reviews
e coli c321 δa exp - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc c321 δa
C321 δa, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/us11939617-331-11-17?v=Addgene+inc
Average 93 stars, based on 1 article reviews
c321 δa - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc dennd3 coding sequence
Dennd3 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/pmc05409492-298-10-24?v=Addgene+inc
Average 90 stars, based on 1 article reviews
dennd3 coding sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

92
Addgene inc atp gidb locus
Atp Gidb Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/pmc05304469-138-12-17?v=Addgene+inc
Average 92 stars, based on 1 article reviews
atp gidb locus - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

91
Addgene inc e coli rho3 strain
E Coli Rho3 Strain, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/wallace_noah_elliot__2021__characterization_and_genetic_manipulation_of_the_plastic_degrading_bacterium_ideonella_sakaiensis-699-16-24?v=Addgene+inc
Average 91 stars, based on 1 article reviews
e coli rho3 strain - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

91
Addgene inc e coli fw102 ol2 62
E Coli Fw102 Ol2 62, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/us11591632-93-10-14?v=Addgene+inc
Average 91 stars, based on 1 article reviews
e coli fw102 ol2 62 - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

90
Addgene inc gst blm
Gst Blm, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/pmc04018780-197-7-40?v=Addgene+inc
Average 90 stars, based on 1 article reviews
gst blm - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Addgene inc k12 strain mg1655 δenda δreca de3
The red and green vertical lines represent the mean wildtype expression levels taken over all eight replicates for BL21 and <t>K12</t> strains, respectively.
K12 Strain Mg1655 δenda δreca De3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/bio_rxiv__2025__06__03__657573-245-6-19?v=Addgene+inc
Average 93 stars, based on 1 article reviews
k12 strain mg1655 δenda δreca de3 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc 104492 aav1
The red and green vertical lines represent the mean wildtype expression levels taken over all eight replicates for BL21 and <t>K12</t> strains, respectively.
104492 Aav1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/pmc07310222__Suppl_TableS1___S5-6-226-145?v=Addgene+inc
Average 90 stars, based on 1 article reviews
104492 aav1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

86
Addgene inc dr1 reporter plasmid
( A ) JMSU-1 and 575A cells were transduced with pBABE retrovirus to express indicated RXRA alleles and expression confirmed by western blot (top) or RT-qPCR in triplicate ± SD (data expressed as a fraction of actin signal). ( B ) Protein coding transcripts up-regulated greater than or equal to twofold (FDR < 0.05) in cells expressing RXRA S427F compared to cells expressing RXRA wt were identified and then subjected to over representation analysis (ORA, GO-Elite) to discover enriched pathways relative to all other protein coding transcripts identified by RNA-seq. Experiment was done in two bladder cancer cell lines, JMSU-1 or 575A, using three RNA samples, each purified from an independent cell well, for each condition. (See also source data 1). ( C ) Transcriptome changes induced by RXRA S427F relative to RXRA wt were compared to expression changes of the same transcripts induced by 16 hr of pioglitazone (1 μM) treatment in the RXRA wt expressing cells. D ) Relative expression of two PPAR targets with expression of indicated RXRA alleles. RT-qPCR performed in triplicate ±SD. Comparison by Student’s t-test. ( E ) RAEs were defined by the presence of overlapping ChIP-seq signal for RXRA and H3K27ac. RAEs identified by binding of RXRA wt and/or RXRA S427F are represented in grey. Hyperactive RAEs represented in red had elevated H3K27ac mean peak height in the mutant expressing cells compared to the wild-type cells (FDR < 0.05). All ChIP-seq peak callings were based on data from three independent immuno-precipitations, each utilizing input material from an independent cell plate. HOMER motif analysis was used to identify motifs enriched in hyperactive RAEs relative to the background of non-hyperactive RAEs. Source data 2 specifies number of peaks in each sector of the venn diagram. ( F ) Activity of a <t>DR1</t> response element reporter (3X PPRE) transfected into JMSU-1 cells stably expressing either RXRA wt or RXRA S427F . RXRA wt cells were also treated with pioglitazone (1 μM) for 16 hr. For all reporter assays, Firefly luciferase expressing reporter was co-transfected with a constitutive Renilla luciferase expression vector to normalize for transfection efficiency. Data represents mean ± SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test. 10.7554/eLife.30862.004 Figure 1—source data 1. GO Elite Over Representation Analysis complete results. Pathways over-represented in genes up-regulated by RXRA S427F compared to RXRA wt in either JMSU-1 or 575A. Analysis was also done using genes up-regulated in both cell lines. 10.7554/eLife.30862.005 Figure 1—source data 2. ChIP-seq peak numbers used to generate venn diagram in .
Dr1 Reporter Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/pmc05720590-33-6-10?v=Addgene+inc
Average 86 stars, based on 1 article reviews
dr1 reporter plasmid - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

93
Addgene inc george church
( A ) JMSU-1 and 575A cells were transduced with pBABE retrovirus to express indicated RXRA alleles and expression confirmed by western blot (top) or RT-qPCR in triplicate ± SD (data expressed as a fraction of actin signal). ( B ) Protein coding transcripts up-regulated greater than or equal to twofold (FDR < 0.05) in cells expressing RXRA S427F compared to cells expressing RXRA wt were identified and then subjected to over representation analysis (ORA, GO-Elite) to discover enriched pathways relative to all other protein coding transcripts identified by RNA-seq. Experiment was done in two bladder cancer cell lines, JMSU-1 or 575A, using three RNA samples, each purified from an independent cell well, for each condition. (See also source data 1). ( C ) Transcriptome changes induced by RXRA S427F relative to RXRA wt were compared to expression changes of the same transcripts induced by 16 hr of pioglitazone (1 μM) treatment in the RXRA wt expressing cells. D ) Relative expression of two PPAR targets with expression of indicated RXRA alleles. RT-qPCR performed in triplicate ±SD. Comparison by Student’s t-test. ( E ) RAEs were defined by the presence of overlapping ChIP-seq signal for RXRA and H3K27ac. RAEs identified by binding of RXRA wt and/or RXRA S427F are represented in grey. Hyperactive RAEs represented in red had elevated H3K27ac mean peak height in the mutant expressing cells compared to the wild-type cells (FDR < 0.05). All ChIP-seq peak callings were based on data from three independent immuno-precipitations, each utilizing input material from an independent cell plate. HOMER motif analysis was used to identify motifs enriched in hyperactive RAEs relative to the background of non-hyperactive RAEs. Source data 2 specifies number of peaks in each sector of the venn diagram. ( F ) Activity of a <t>DR1</t> response element reporter (3X PPRE) transfected into JMSU-1 cells stably expressing either RXRA wt or RXRA S427F . RXRA wt cells were also treated with pioglitazone (1 μM) for 16 hr. For all reporter assays, Firefly luciferase expressing reporter was co-transfected with a constitutive Renilla luciferase expression vector to normalize for transfection efficiency. Data represents mean ± SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test. 10.7554/eLife.30862.004 Figure 1—source data 1. GO Elite Over Representation Analysis complete results. Pathways over-represented in genes up-regulated by RXRA S427F compared to RXRA wt in either JMSU-1 or 575A. Analysis was also done using genes up-regulated in both cell lines. 10.7554/eLife.30862.005 Figure 1—source data 2. ChIP-seq peak numbers used to generate venn diagram in .
George Church, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bacterial+strains/pmc12203648-296-5-7?v=Addgene+inc
Average 93 stars, based on 1 article reviews
george church - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

Image Search Results


The red and green vertical lines represent the mean wildtype expression levels taken over all eight replicates for BL21 and K12 strains, respectively.

Journal: bioRxiv

Article Title: Negative epistasis limits current codon optimization approaches

doi: 10.1101/2025.06.03.657573

Figure Lengend Snippet: The red and green vertical lines represent the mean wildtype expression levels taken over all eight replicates for BL21 and K12 strains, respectively.

Article Snippet: E. coli K12(DE3) corresponds to the K12 strain MG1655 ΔendA ΔrecA (DE3) and was a gift from Kristala Prather (Addgene plasmid # 37854)[ ].

Techniques: Expressing

(A) Protein expression levels (in arbitrary units (AU) of fluorescence levels) for all 22 optimized sequences expressed in the BL21, and for 13 sequences expressed in K12. (B) Protein expression levels of BL21 versus K12. Estimate uncertainties are given with two standard deviations (sd) –one sd for each direction pointing away from the mean– of eight replicate measurements taken per sequence and strain. Standard linear regression is shown as a blue line, while the grey area represents the 95% confidence range of possible regression line slopes under a Student t-distribution. (C) Protein expression levels versus enzymatic activity for expression products from both BL21 and K12. Uncertainty ranges are computed as in B).

Journal: bioRxiv

Article Title: Negative epistasis limits current codon optimization approaches

doi: 10.1101/2025.06.03.657573

Figure Lengend Snippet: (A) Protein expression levels (in arbitrary units (AU) of fluorescence levels) for all 22 optimized sequences expressed in the BL21, and for 13 sequences expressed in K12. (B) Protein expression levels of BL21 versus K12. Estimate uncertainties are given with two standard deviations (sd) –one sd for each direction pointing away from the mean– of eight replicate measurements taken per sequence and strain. Standard linear regression is shown as a blue line, while the grey area represents the 95% confidence range of possible regression line slopes under a Student t-distribution. (C) Protein expression levels versus enzymatic activity for expression products from both BL21 and K12. Uncertainty ranges are computed as in B).

Article Snippet: E. coli K12(DE3) corresponds to the K12 strain MG1655 ΔendA ΔrecA (DE3) and was a gift from Kristala Prather (Addgene plasmid # 37854)[ ].

Techniques: Expressing, Fluorescence, Sequencing, Activity Assay

Upper panel: Hamming distance from reference strain –the JCat optimized sequence– versus protein expression levels in units of the mean protein expression of the JCat sequence, minus one. Data points are shown for all measured replicates per sequence. No outliers were omitted. The fit of model (2) is shown as a royal blue line. The grey area around the regression line indicates the 95% uncertainty in the estimates of the two evaluated coefficients. Lower panel: Analogous to upper panel, but for the data measured in the K12 strain.

Journal: bioRxiv

Article Title: Negative epistasis limits current codon optimization approaches

doi: 10.1101/2025.06.03.657573

Figure Lengend Snippet: Upper panel: Hamming distance from reference strain –the JCat optimized sequence– versus protein expression levels in units of the mean protein expression of the JCat sequence, minus one. Data points are shown for all measured replicates per sequence. No outliers were omitted. The fit of model (2) is shown as a royal blue line. The grey area around the regression line indicates the 95% uncertainty in the estimates of the two evaluated coefficients. Lower panel: Analogous to upper panel, but for the data measured in the K12 strain.

Article Snippet: E. coli K12(DE3) corresponds to the K12 strain MG1655 ΔendA ΔrecA (DE3) and was a gift from Kristala Prather (Addgene plasmid # 37854)[ ].

Techniques: Sequencing, Expressing

( A ) JMSU-1 and 575A cells were transduced with pBABE retrovirus to express indicated RXRA alleles and expression confirmed by western blot (top) or RT-qPCR in triplicate ± SD (data expressed as a fraction of actin signal). ( B ) Protein coding transcripts up-regulated greater than or equal to twofold (FDR < 0.05) in cells expressing RXRA S427F compared to cells expressing RXRA wt were identified and then subjected to over representation analysis (ORA, GO-Elite) to discover enriched pathways relative to all other protein coding transcripts identified by RNA-seq. Experiment was done in two bladder cancer cell lines, JMSU-1 or 575A, using three RNA samples, each purified from an independent cell well, for each condition. (See also source data 1). ( C ) Transcriptome changes induced by RXRA S427F relative to RXRA wt were compared to expression changes of the same transcripts induced by 16 hr of pioglitazone (1 μM) treatment in the RXRA wt expressing cells. D ) Relative expression of two PPAR targets with expression of indicated RXRA alleles. RT-qPCR performed in triplicate ±SD. Comparison by Student’s t-test. ( E ) RAEs were defined by the presence of overlapping ChIP-seq signal for RXRA and H3K27ac. RAEs identified by binding of RXRA wt and/or RXRA S427F are represented in grey. Hyperactive RAEs represented in red had elevated H3K27ac mean peak height in the mutant expressing cells compared to the wild-type cells (FDR < 0.05). All ChIP-seq peak callings were based on data from three independent immuno-precipitations, each utilizing input material from an independent cell plate. HOMER motif analysis was used to identify motifs enriched in hyperactive RAEs relative to the background of non-hyperactive RAEs. Source data 2 specifies number of peaks in each sector of the venn diagram. ( F ) Activity of a DR1 response element reporter (3X PPRE) transfected into JMSU-1 cells stably expressing either RXRA wt or RXRA S427F . RXRA wt cells were also treated with pioglitazone (1 μM) for 16 hr. For all reporter assays, Firefly luciferase expressing reporter was co-transfected with a constitutive Renilla luciferase expression vector to normalize for transfection efficiency. Data represents mean ± SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test. 10.7554/eLife.30862.004 Figure 1—source data 1. GO Elite Over Representation Analysis complete results. Pathways over-represented in genes up-regulated by RXRA S427F compared to RXRA wt in either JMSU-1 or 575A. Analysis was also done using genes up-regulated in both cell lines. 10.7554/eLife.30862.005 Figure 1—source data 2. ChIP-seq peak numbers used to generate venn diagram in .

Journal: eLife

Article Title: Bladder-cancer-associated mutations in RXRA activate peroxisome proliferator-activated receptors to drive urothelial proliferation

doi: 10.7554/eLife.30862

Figure Lengend Snippet: ( A ) JMSU-1 and 575A cells were transduced with pBABE retrovirus to express indicated RXRA alleles and expression confirmed by western blot (top) or RT-qPCR in triplicate ± SD (data expressed as a fraction of actin signal). ( B ) Protein coding transcripts up-regulated greater than or equal to twofold (FDR < 0.05) in cells expressing RXRA S427F compared to cells expressing RXRA wt were identified and then subjected to over representation analysis (ORA, GO-Elite) to discover enriched pathways relative to all other protein coding transcripts identified by RNA-seq. Experiment was done in two bladder cancer cell lines, JMSU-1 or 575A, using three RNA samples, each purified from an independent cell well, for each condition. (See also source data 1). ( C ) Transcriptome changes induced by RXRA S427F relative to RXRA wt were compared to expression changes of the same transcripts induced by 16 hr of pioglitazone (1 μM) treatment in the RXRA wt expressing cells. D ) Relative expression of two PPAR targets with expression of indicated RXRA alleles. RT-qPCR performed in triplicate ±SD. Comparison by Student’s t-test. ( E ) RAEs were defined by the presence of overlapping ChIP-seq signal for RXRA and H3K27ac. RAEs identified by binding of RXRA wt and/or RXRA S427F are represented in grey. Hyperactive RAEs represented in red had elevated H3K27ac mean peak height in the mutant expressing cells compared to the wild-type cells (FDR < 0.05). All ChIP-seq peak callings were based on data from three independent immuno-precipitations, each utilizing input material from an independent cell plate. HOMER motif analysis was used to identify motifs enriched in hyperactive RAEs relative to the background of non-hyperactive RAEs. Source data 2 specifies number of peaks in each sector of the venn diagram. ( F ) Activity of a DR1 response element reporter (3X PPRE) transfected into JMSU-1 cells stably expressing either RXRA wt or RXRA S427F . RXRA wt cells were also treated with pioglitazone (1 μM) for 16 hr. For all reporter assays, Firefly luciferase expressing reporter was co-transfected with a constitutive Renilla luciferase expression vector to normalize for transfection efficiency. Data represents mean ± SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test. 10.7554/eLife.30862.004 Figure 1—source data 1. GO Elite Over Representation Analysis complete results. Pathways over-represented in genes up-regulated by RXRA S427F compared to RXRA wt in either JMSU-1 or 575A. Analysis was also done using genes up-regulated in both cell lines. 10.7554/eLife.30862.005 Figure 1—source data 2. ChIP-seq peak numbers used to generate venn diagram in .

Article Snippet: recombinant DNA reagent , PPRE X3-TK-luc; DR1 reporter (plasmid) , Addgene; PMID 9539737 , Addgene:1015 , plasmid was deposited by Bruce Spiegelman.

Techniques: Transduction, Expressing, Western Blot, Quantitative RT-PCR, RNA Sequencing, Purification, Comparison, ChIP-sequencing, Binding Assay, Mutagenesis, Activity Assay, Transfection, Stable Transfection, Luciferase, Plasmid Preparation

A ) PPAR RNA expression in RXRA hot-spot mutant clinical samples from the TCGA dataset. Whisker plot shows 25 th , median, and 75 th percentile. ( B ) Data from panel A plotted per patient with hot-spot mutation. ( C ) Effects of siRNA-mediated knock-down of PPARD and PPARG in JMSU-1 and 575A cell lines on two target genes ( PLIN2 and FABP3 ) up-regulated by mutant RXRA. Data by RT-qPCR in triplicate ±SD and indicated comparisons by Student’s t-test. ( D ) DR1 luciferase reporter activity in UM-UC-3 cells transfected with RXRA ±PPARD or PPARG. Cells were treated with 1 µM of the PPARG agonist pioglitazone or the PPARD agonist GW0742 for 16 hr. Data represents mean ±SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test.

Journal: eLife

Article Title: Bladder-cancer-associated mutations in RXRA activate peroxisome proliferator-activated receptors to drive urothelial proliferation

doi: 10.7554/eLife.30862

Figure Lengend Snippet: A ) PPAR RNA expression in RXRA hot-spot mutant clinical samples from the TCGA dataset. Whisker plot shows 25 th , median, and 75 th percentile. ( B ) Data from panel A plotted per patient with hot-spot mutation. ( C ) Effects of siRNA-mediated knock-down of PPARD and PPARG in JMSU-1 and 575A cell lines on two target genes ( PLIN2 and FABP3 ) up-regulated by mutant RXRA. Data by RT-qPCR in triplicate ±SD and indicated comparisons by Student’s t-test. ( D ) DR1 luciferase reporter activity in UM-UC-3 cells transfected with RXRA ±PPARD or PPARG. Cells were treated with 1 µM of the PPARG agonist pioglitazone or the PPARD agonist GW0742 for 16 hr. Data represents mean ±SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test.

Article Snippet: recombinant DNA reagent , PPRE X3-TK-luc; DR1 reporter (plasmid) , Addgene; PMID 9539737 , Addgene:1015 , plasmid was deposited by Bruce Spiegelman.

Techniques: RNA Expression, Mutagenesis, Whisker Assay, Knockdown, Quantitative RT-PCR, Luciferase, Activity Assay, Transfection

( A ) DR1 and DR5 luciferase reporter activity in UM-UC-3 cells transfected with RXRA ±RARA as indicated and treated with 100 nM all-trans-retinoic acid (ATRA) for 16 hr.

Journal: eLife

Article Title: Bladder-cancer-associated mutations in RXRA activate peroxisome proliferator-activated receptors to drive urothelial proliferation

doi: 10.7554/eLife.30862

Figure Lengend Snippet: ( A ) DR1 and DR5 luciferase reporter activity in UM-UC-3 cells transfected with RXRA ±RARA as indicated and treated with 100 nM all-trans-retinoic acid (ATRA) for 16 hr.

Article Snippet: recombinant DNA reagent , PPRE X3-TK-luc; DR1 reporter (plasmid) , Addgene; PMID 9539737 , Addgene:1015 , plasmid was deposited by Bruce Spiegelman.

Techniques: Luciferase, Activity Assay, Transfection

A ) RXRA S427 and other amino acids mutated for structure-function studies highlighted in green on a published full-length crystal structure of a RXRA/PPARG heterodimer. ( B ) DR1 reporter assay in UM-UC-3 co-transfecting indicated RXRA and PPARG alleles. Cells were treated with vehicle (DMSO) or pioglitazone 1 µM for 16 hr. Data represents mean normalized signal ±SEM of three independent experiments done on different days, each performed in triplicate, with data from each experiment normalized to the RXRA wt vehicle condition for each section. Statistical comparisons are by unpaired t -test. ( C ) Left, reporter assay performed with indicated RXRA alleles only and drug treatment with the RXRA agonist SR11237 (100 nM) for 16 hr. Right, reporter assay with wild-type PPARG co-transfected. Data represent mean ±SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test. ( D ) Published agonist structure of RXRA/PPARG heterodimer (PDB: 1FM6) in red and blue with key residues highlighted in bright green. Top three occupied microstate clusters from simulation experiments are superimposed. ( E ) Distance from starting agonist structure between alpha carbons of RXR 427 and PPARG 477 in the top 5% most-occupied microstates for wild-type and mutant RXRA. Mean ±SD, comparison is by Student’s t test. ( F ) Alignment of the AF2 region and C-terminus of all RXRA dimerization partners. Terminal tyrosine unique to PPARs is indicated. ( G ) Reporter assay similar to B, but using PPARD and the PPARD agonist GW0742.

Journal: eLife

Article Title: Bladder-cancer-associated mutations in RXRA activate peroxisome proliferator-activated receptors to drive urothelial proliferation

doi: 10.7554/eLife.30862

Figure Lengend Snippet: A ) RXRA S427 and other amino acids mutated for structure-function studies highlighted in green on a published full-length crystal structure of a RXRA/PPARG heterodimer. ( B ) DR1 reporter assay in UM-UC-3 co-transfecting indicated RXRA and PPARG alleles. Cells were treated with vehicle (DMSO) or pioglitazone 1 µM for 16 hr. Data represents mean normalized signal ±SEM of three independent experiments done on different days, each performed in triplicate, with data from each experiment normalized to the RXRA wt vehicle condition for each section. Statistical comparisons are by unpaired t -test. ( C ) Left, reporter assay performed with indicated RXRA alleles only and drug treatment with the RXRA agonist SR11237 (100 nM) for 16 hr. Right, reporter assay with wild-type PPARG co-transfected. Data represent mean ±SEM of Firefly to Renilla luciferase signal from three independent experiments done on different days, each performed using triplicate cell wells. Statistical comparisons are by paired t -test. ( D ) Published agonist structure of RXRA/PPARG heterodimer (PDB: 1FM6) in red and blue with key residues highlighted in bright green. Top three occupied microstate clusters from simulation experiments are superimposed. ( E ) Distance from starting agonist structure between alpha carbons of RXR 427 and PPARG 477 in the top 5% most-occupied microstates for wild-type and mutant RXRA. Mean ±SD, comparison is by Student’s t test. ( F ) Alignment of the AF2 region and C-terminus of all RXRA dimerization partners. Terminal tyrosine unique to PPARs is indicated. ( G ) Reporter assay similar to B, but using PPARD and the PPARD agonist GW0742.

Article Snippet: recombinant DNA reagent , PPRE X3-TK-luc; DR1 reporter (plasmid) , Addgene; PMID 9539737 , Addgene:1015 , plasmid was deposited by Bruce Spiegelman.

Techniques: Reporter Assay, Transfection, Luciferase, Mutagenesis, Comparison

Journal: eLife

Article Title: Bladder-cancer-associated mutations in RXRA activate peroxisome proliferator-activated receptors to drive urothelial proliferation

doi: 10.7554/eLife.30862

Figure Lengend Snippet:

Article Snippet: recombinant DNA reagent , PPRE X3-TK-luc; DR1 reporter (plasmid) , Addgene; PMID 9539737 , Addgene:1015 , plasmid was deposited by Bruce Spiegelman.

Techniques: Generated, Plasmid Preparation, Infection, In Vitro, Recombinant, Mutagenesis, Clone Assay, Sequencing, Luciferase, Software